RAB23 (NM_001278666) Human Untagged Clone

CAT#: SC334701

RAB23 (untagged) - Human RAB23, member RAS oncogene family (RAB23), transcript variant 3



  "NM_001278666" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RAB23 mouse monoclonal antibody,clone OTI2A8
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC137
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278666, the custom clone sequence may differ by one or more nucleotides


ATGTTGGAGGAAGATATGGAAGTCGCCATAAAGATGGTGGTTGTAGGGAATGGAGCAGTTGGAAAATCAA
GTATGATTCAGCGATATTGCAAAGGCATTTTTACAAAAGACTACAAGAAAACCATTGGAGTTGATTTTTT
GGAGCGACAAATTCAAGTTAATGATGAAGATGTCAGACTAATGTTATGGGACACTGCAGGTCAGGAGGAA
TTTGATGCAATTACAAAGGCCTACTATCGAGGAGCCCAGGCTTGTGTGCTCGTGTTCTCTACCACAGATA
GGGAATCTTTTGAAGCAGTTTCCAGTTGGAGAGAGAAAGTAGTAGCCGAAGTGGGAGATATACCAACTGT
ACTTGTGCAAAACAAGATTGATCTTCTGGATGATTCTTGTATAAAGAATGAGGAAGCTGAGGCACTGGCA
AAAAGGTTAAAGTTAAGATTCTACAGAACATCAGTGAAAGAAGATCTAAATGTGAATGAAGTTTTTAAGT
ATTTGGCTGAAAAATACCTTCAGAAACTCAAACAACAAATAGCTGAGGATCCAGAACTAACGCATTCAAG
TAGTAACAAGATTGGTGTCTTTAATACATCTGGTGGAAGTCACTCCGGTCAGAATTCAGGTACCCTCAAT
GGTGGAGATGTCATCAATCTTAGACCCAACAAACAAAGGACCAAGAAAAACAGAAATCCTTTTAGCAGCT
GTAGCATACCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278666
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278666.1, NP_001265595.1
RefSeq Size 4368 bp
RefSeq ORF 714 bp
Locus ID 51715
UniProt ID Q9ULC3
Protein Families Druggable Genome
Protein Pathways Hedgehog signaling pathway
Gene Summary This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...