MTRF1L (NM_001301047) Human Untagged Clone

CAT#: SC334686

MTRF1L (untagged) - Human mitochondrial translational release factor 1-like (MTRF1L), transcript variant 5



  "NM_001301047" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-MTRF1L mouse monoclonal antibody, clone OTI2B5 (formerly 2B5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HMRF1L; MRF1L; mtRF1a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301047, the custom clone sequence may differ by one or more nucleotides


ATGCGGTCCCGGGTTCTGTGGGGCGCTGCCCGGTGGCTCTGGCCCCGCCGGGCCGTTGGCCCAGCCCGCC
GGCCCCTGAGCTCCGGTAGCCCGCCGCTGGAGGAGCTGTTCACCCGGGGCGGGCCCTTGCGGACCTTCCT
CGAGCGCCAGGCGGGGTCTGAAGCCCATTTGAAGGTCAGGAGGCCCGAGTTGCTGGCGGTGATCAAACTG
CTGAACGAGAAGGAGCGGGAGCTGCGGGAGACTGAGCACTTGCTGCACGATGAGAATGAAGATTTAAGGA
AACTTGCAGAGAATGAAATCACTTTGTGTCAAAAAGAAATAACTCAGCTGAAGCATCAGATTATCTTACT
TTTGGTTCCCTCAGAAGAAACAGATGAAAATGATTTGATCCTGGAAGTAACTGCAGGAGTTGGAGGTGGC
CTTAGACATGCATCTGCCAGCATTGGGGGTTCAGAAGCCTATAGGCACATGAAATTTGAAGGAGGTGTTC
ACAGAGTACAAAGAGTGCCAAAGACAGAAAAGCAAGGCCGCGTCCATACTAGCACCATGACTGTAGCAAT
ATTACCCCAGCCTACTGAGATTAATCTGGTGATTAATCCGAAAGATTTGAGAATTGACACTAAGCGAGCC
AGTGGAGCTGGGGGGCAGCATGTAAATACCACGGACAGTGCTGTCCGGATAGTTCATCTTCCAACAGATT
GGAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301047
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301047.2, NP_001287976.1
RefSeq Size 3570 bp
RefSeq ORF 708 bp
Locus ID 54516
UniProt ID Q9UGC7
Gene Summary The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, and lacks an alternate exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. This variant encodes isoform 5, which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...