KCNN2 (NM_001278204) Human Untagged Clone
CAT#: SC334650
KCNN2 (untagged) - Human potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hSK2; KCa2.2; SK2; SKCA2; SKCa 2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278204, the custom clone sequence may differ by one or more nucleotides
ATGTGGTTGATATCAATAACTTTTCTCTCCATTGGTTATGGTGACATGGTACCTAACACATACTGTGGAA AAGGAGTCTGCTTACTTACTGGAATTATGGGTGCTGGTTGCACAGCCCTGGTGGTAGCTGTAGTGGCAAG GAAGCTAGAACTTACCAAAGCAGAAAAACACGTGCACAATTTCATGATGGATACTCAGCTGACTAAAAGA GTAAAAAATGCAGCTGCCAATGTACTCAGGGAAACATGGCTAATTTACAAAAATACAAAGCTAGTGAAAA AGATAGATCATGCAAAAGTAAGAAAACATCAACGAAAATTCCTGCAAGCTATTCATCAATTAAGAAGTGT AAAAATGGAGCAGAGGAAACTGAATGACCAAGCAAACACTTTGGTGGACTTGGCAAAGACCCAGAACATC ATGTATGATATGATTTCTGACTTAAACGAAAGGAGTGAAGACTTCGAGAAGAGGATTGTTACCCTGGAAA CAAAACTAGAGACTTTGATTGGTAGCATCCACGCCCTCCCTGGGCTCATAAGCCAGACCATCAGGCAGCA GCAGAGAGATTTCATTGAGGCTCAGATGGAGAGCTACGACAAGCACGTCACTTACAATGCTGAGCGGTCC CGGTCCTCGTCCAGGAGGCGGCGGTCCTCTTCCACAGCACCACCAACTTCATCAGAGAGTAGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278204 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278204.1, NP_001265133.1 |
RefSeq Size | 2112 bp |
RefSeq ORF | 696 bp |
Locus ID | 3781 |
UniProt ID | Q9H2S1 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region and initiates translation at a downstream start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (b), which is shorter at the N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236756 | KCNN2 (myc-DDK-tagged) - Human potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 3 |
CNY 2,400.00 |
|
RG236756 | KCNN2 (tGFP-tagged) - Human potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (KCNN2), transcript variant 3 |
CNY 4,370.00 |