MDH2 (NM_001282404) Human Untagged Clone
CAT#: SC334649
MDH2 (untagged) - Human malate dehydrogenase 2, NAD (mitochondrial) (MDH2), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Rabbit Polyclonal antibody to MDH2 (malate dehydrogenase 2, NAD (mitochondrial))
CNY 6,281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEE51; EIEE51; M-MDH; MDH; MGC:3559; MOR1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282404, the custom clone sequence may differ by one or more nucleotides
ATGACCCGGGACGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGC ACTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCACAGCAGAAGT TTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGACCCTGGACATCGTCAGAGCC AACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCGAGTCAACGTCCCTGTCATTGGTGGCCATG CTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGAC AGCACTCACTGGGCGGATCCAGGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCC ACCCTCTCCATGGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAG GTGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACCGCTGCTGCT TGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTTTGAGGAGAAGATGATCTCG GATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGAAGATTTCGTGAAGACCCTGAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282404 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282404.1, NP_001269333.1 |
RefSeq Size | 2099 bp |
RefSeq ORF | 696 bp |
Locus ID | 4191 |
UniProt ID | P40926 |
Protein Families | Druggable Genome |
Protein Pathways | Citrate cycle (TCA cycle), Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Pyruvate metabolism |
Gene Summary | Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (3) lacks an alternate exon compared to variant 1, that causes translation to begin at a downstream AUG. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...