beta Casein (CSN2) (NM_001302770) Human Untagged Clone

CAT#: SC334607

CSN2 (untagged) - Human casein beta (CSN2), transcript variant 2



  "NM_001302770" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CSN2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CASB; PDC213
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302770, the custom clone sequence may differ by one or more nucleotides


ATGAAGGTCCTCATCCTCGCCTGCCTGGTGGCTCTTGCTCTTGCAAGGGAGACCATAGAAAGCCTTTCAA
GCAGTGAGGAATCTATTACAGAATACAAGAAAGTTGAGAAGGTTAAACATGAGGACCAGCAGCAAGGAGA
GGATGAACACCAGGATAAAATCTACCCCTCTTTCCAGCCACAGCCTCTGATCTATCCATTCGTTGAACCT
ATCCCCTATGGTTTTCTTCCACAAAACATTCTGCCTCTTGCTCAGCCTGCTGTGGTGCTGCCTGTCCCTC
AGCCTGAAATAATGGAAGTCCCTAAAGCTAAAGACACTGTCTACACTAAGGGCAGAGTGATGCCTGTCCT
TAAATCTCCAACGATACCCTTTTTTGACCCTCAAATCCCAAAACTCACTGATCTTGAAAATCTGCATCTT
CCTCTGCCTCTGCTCCAGCCCTTGATGCAGCAGGTCCCTCAGCCTATTCCTCAGACTCTTGCACTTCCCC
CTCAGCCCCTGTGGTCTGTTCCTCAGCCCAAAGTCCTGCCTATCCCCCAGCAAGTGGTGCCCTACCCTCA
GAGAGCTGTGCCTGTTCAAGCCCTTCTGCTCAACCAAGAACTTCTACTTAACCCCACCCACCAGATCTAC
CCTGTGACTCAGCCACTTGCCCCAGTTCATAACCCCATTAGTGTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001302770
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302770.1, NP_001289699.1
RefSeq Size 1078 bp
RefSeq ORF 678 bp
Locus ID 1447
UniProt ID P05814
Protein Families Secreted Protein
Gene Summary This gene is a member of the beta casein family. There are two types of casein protein, beta (encoded by this gene) and kappa, both of which are secreted in human milk. Beta casein is the principal protein in human milk and the primary source of essential amino acids for a suckling infant. Beta and kappa casein proteins acting together form spherical micelles which bind within them important dietary minerals, such as calcium and phosphorous. In addition, the C-terminal 14 aa of the protein has antimicrobial activity, especially in preterm milk, displaying antibacterial activity against S. aureus and Y. enterocolitica. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...