MRPS34 (NM_001300900) Human Untagged Clone
CAT#: SC334602
MRPS34 (untagged) - Human mitochondrial ribosomal protein S34 (MRPS34), transcript variant 1
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
MRPS34 mouse monoclonal antibody, clone OTI4H2 (formerly 4H2)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COXPD32; MRP-S12; MRP-S34; MRPS12 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300900, the custom clone sequence may differ by one or more nucleotides
ATGGCGCGGAAGAAGGTGCGTCCGCGGCTGATCGCGGAGCTGGCCCGCCGCGTGCGCGCCCTGCGGGAGC AACTGAACAGGCCGCGCGACTCCCAGCTCTACGCGGTGGACTACGAGACCTTGACGCGGCCGTTCTCTGG ACGCCGGCTGCCGGTCCGGGCCTGGGCCGACGTGCGCCGCGAGAGCCGCCTCTTGCAGCTGCTCGGCCGC CTCCCGCTCTTCGGCCTGGGCCGCCTGGTCACGCGCAAGTCCTGGCTGTGGCAGCACGACGAGCCGTGCT ACTGGCGCCTCACGCGGGTGCGGCCCGACTACACGGCGCAGAACTTGGACCACGGGAAGGCCTGGGGCAT CCTGACCTTCAAAGACGCCTCTTTTTCTTCATCAGGGAAGACTGAGAGCGAGGCGCGGGAGATCGAACAC GTCATGTACCATGACTGGCGGCTGGTGCCCAAGCACGAGGAGGAGGCCTTCACCGCGTTCACGCCGGCGC CGGAAGACAGCCTGGCCTCCGTGCCGTACCCGCCTCTCCTCCGGGCCATGATTATCGCAGAACGACAGAA AAATGGAGACACAAGCACCGAGGAGCCCATGCTGAATGTGCAGAGGATACGCATGGAACCCTGGGATTAC CCTGCAAAACAGGAAGACAAAGGAAGGGCCAAGGGCACCCCCGTCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300900 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300900.1, NP_001287829.1 |
RefSeq Size | 1041 bp |
RefSeq ORF | 678 bp |
Locus ID | 65993 |
UniProt ID | P82930 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...