SLC35A2 (NM_001282647) Human Untagged Clone
CAT#: SC334599
SLC35A2 (untagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDG2M; CDGX; UDP-Gal-Tr; UGALT; UGAT; UGT; UGT1; UGT2; UGTL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282647, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGGTTGGGGCTGGTGGTTCCACCGCGGCGCCCGGGCCAGGGGCGGTTTCCGCGGGTGCATTGG AGCCGGGGACCGCCAGTGCGGCTCACAGGCGCCTGAAGTACATATCCCTAGCTGTGCTGGTGGTCCAGAA TGCCTCCCTCATCCTCAGCATCCGCTACGCCCGCACGTTGCCAGGGGACCGCTTCTTTGCCACCACTGCT GTGGTCATGGCGGAAGTGCTCAAAGGTCTCACCTGCCTGCTGCTGCTCTTCGCACAGAAGAGGGGTAACG TGAAGCACCTGGTTCTCTTCCTCCATGAGGCTGTCCTGGTGCAGTATGTGGACACGCTCAAGCTCGCAGT GCCCTCTCTCATCTACACCTTGCAGAATAACCTCCAGTATGTTGCCATCTCTAACCTACCAGCTGCCACT TTCCAGCCTTCCCCGAGGTGCAGCCAAAGCCATAGCCTCTGCCTCTGCCTCCGCCTCCGGGCCCTGCGTT CACCAGCAGCCTCCCGGGCAGCCACCACCACCGCAGCTGTCTTCCCACCGTGGAGACCTCATCACGGAGC CCTTTCTGCCAAAGTTGCTCACCAAGGTGAAGGGTTCCTAGCCGCTGGGATTGAAGACATTGGCCTGGCC TCGTTCTCTCTTCTTGCCCTTGGCCCAGCTGGGACCAAACTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282647 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282647.1, NP_001269576.1 |
RefSeq Size | 1195 bp |
RefSeq ORF | 675 bp |
Locus ID | 7355 |
UniProt ID | P78381 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the nucleotide-sugar transporter family. The encoded protein is a multi-pass membrane protein. It transports UDP-galactose from the cytosol into Golgi vesicles, where it serves as a glycosyl donor for the generation of glycans. Mutations in this gene cause congenital disorder of glycosylation type IIm (CDG2M). Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236705 | SLC35A2 (myc-DDK-tagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 4 |
CNY 3,990.00 |
|
RG236705 | SLC35A2 (tGFP-tagged) - Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 4 |
CNY 4,370.00 |
其它SLC35A2产品