WFDC1 (NM_001282466) Human Untagged Clone

CAT#: SC334560

WFDC1 (untagged) - Human WAP four-disulfide core domain 1 (WFDC1), transcript variant 2



  "NM_001282466" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


WFDC1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PS20
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282466, the custom clone sequence may differ by one or more nucleotides


ATGCCTTTAACCGGCGTGGGGCCGGGCAGCTGCAGGAGGCAGATCATCCGGGCTCTGTGCCTCTTGCTAC
TTCTCCTCCACGCCGGCTCTGCCAAGAATATCTGGAAACGGGCATTGCCTGCGAGGCTGGCCGAGAAATC
CCGTGCCGAGGAGGCGGGCGCGCCCGGCGGCCCCCGGCAGCCCCGAGCAGACCGCTGCCCGCCGCCTCCG
CGGACGCTGCCCCCCGGCGCCTGCCAGGCCGCGCGCTGTCAGGCGGACTCCGAGTGCCCGCGGCACCGGC
GCTGCTGCTACAACGGATGCGCCTACGCCTGCCTAGAAGCTGTGCCGCCCCCGCCAGTCTTAGACTGGCT
GGTGCAGCCGAAACCTCGATGGCTTGGTGGCAATGGCTGGCTCCTGGATGGCCCTGAGGAGGTGTTACAA
GCAGAGGCGTGCAGCACCACGGAGGATGGGGCCGAACCCCTGCTCTGTCCCTCGGGCTATGAGTGCCACA
TCCTGAGCCCAGGTGACGTGGCCGAAGGTATCCCCAACCGTGGGCAGTGCGTCAAGCAGCGCCGGCAAGC
AGATGGGCGAATCCTACGACACAAACTTTACAAAGAATATCCAGAAGGTGACTCAAAGAATGTGGCAGAA
CCTGGAAGGGGACAACAGAAGCACTTTCAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282466
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282466.1, NP_001269395.1
RefSeq Size 1475 bp
RefSeq ORF 663 bp
Locus ID 58189
UniProt ID Q9HC57
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. This gene is downregulated in many cancer types and may be involved in the inhibition of cell proliferation. The encoded protein may also play a role in the susceptibility of certain CD4 memory T cells to human immunodeficiency virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) differs in the 3' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...