SSX2 (SSX2B) (NM_001278702) Human Untagged Clone

CAT#: SC334523

SSX2B (untagged) - Human synovial sarcoma, X breakpoint 2B (SSX2B), transcript variant 3



  "NM_001278702" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SSX2B Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT5.2; CT5.2b; HOM-MEL-40; SSX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278702, the custom clone sequence may differ by one or more nucleotides


ATGAACGGAGACGACGCCTTTGCAAGGAGACCCACGGTTGGTGCTCAAATACCAGAGAAGATCCAAAAGG
CCTTCGATGATATTGCCAAATACTTCTCTAAGGAAGAGTGGGAAAAGATGAAAGCCTCGGAGAAAATCTT
CTATGTGTATATGAAGAGAAAGTATGAGGCTATGACTAAACTAGGTTTCAAGGCCACCCTCCCACCTTTC
ATGTGTAATAAACGGGCCGAAGACTTCCAGGGGAATGATTTGGATAATGACCCTAACCGTGGGAATCAGG
TTGAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTCCCCGAAGATCATGCCCAAGAAGCCAGC
AGAGGAAGGAAATGATTCGGAGGAAGTGCCAGAAGCATCTGGCCCACAAAATGATGGGAAAGAGCTGTGC
CCCCCGGGAAAACCAACTACCTCTGAGAAGATTCACGAGAGATCTGGAAATAGGGAGGCCCAAGAAAAGG
AAGAGAGACGCGGAACAGCTCATCGGTGGAGCAGTCAGAACACACACAACATTGGACCCAAAAGGGGGGA
ACATGCCTGGACCCACAGACTGCGTGAGAGAAAACAGCTGGTGATTTATGAAGAGATCAGCGACCCTGAG
GAAGATGACGAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278702
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278702.1, NP_001265631.1
RefSeq Size 1425 bp
RefSeq ORF 645 bp
Locus ID 727837
UniProt ID Q16385
Gene Summary The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. This gene, and also the SSX1 and SSX4 family members, have been involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. This gene also has an identical duplicate, GeneID: 6757, located about 45 kb upstream in the opposite orientation on chromosome X. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (c) contains a shorter and distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...