Lysophospholipase 1 (LYPLA1) (NM_001279357) Human Untagged Clone

CAT#: SC334517

LYPLA1 (untagged) - Human lysophospholipase I (LYPLA1), transcript variant 3



  "NM_001279357" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
LYPLA1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APT-1; APT1; hAPT1; LPL-I; LPL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001279357, the custom clone sequence may differ by one or more nucleotides


ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCCACCGCTGCGG
TGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCCTTTGCAGGTATCAGAAGTTC
ACATATCAAATATATCTGCCCGCATGCGTTTGATATTATTGGGCTTTCACCAGATTCACAGGAGGATGAA
TCTGGGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATTGATCAAGAAGTGAAGAATGGCATTCCTT
CTAACAGAATTATTTTGGGAGGGTTTTCTCAGGGAGGAGCTTTATCTTTATATACTGCCCTTACCACACA
GCAGAAACTGGCAGGTGTCACTGCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCT
ATCGGTGGTGCTAATAGAGATATTTCTATTCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGA
TGTTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTTAAAACCTA
TGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAATTCATTGATAAACTCCTA
CCTCCAATTGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001279357
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001279357.1, NP_001266286.1
RefSeq Size 2548 bp
RefSeq ORF 645 bp
Locus ID 10434
UniProt ID O75608
Protein Pathways Glycerophospholipid metabolism
Gene Summary This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...