HEY1 (NM_001282851) Human Untagged Clone
CAT#: SC334514
HEY1 (untagged) - Human hes-related family bHLH transcription factor with YRPW motif 1 (HEY1), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BHLHb31; CHF2; HERP2; HESR1; hHRT1; HRT-1; NERP2; OAF1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282851, the custom clone sequence may differ by one or more nucleotides
ATGCCTCTTGAGGAAAGAAATGTATTCTGGTTAAGTAAAGGAAACCTAACGGGAGACCAAGGTTACTTTG ACGCGCACGCCCTTGCTATGGACTATCGGAGTTTGGGATTTCGGGAATGCCTGGCAGAAGTTGCGCGTTA TCTGAGCATCATTGAAGGACTAGATGCCTCTGACCCGCTTCGAGTTCGACTGGTTTCGCATCTCAACAAC TACGCTTCCCAGCGGGAAGCCGCGAGCGGCGCCCACGCGGGCCTCGGACACATTCCCTGGGGGACCGTCT TCGGACATCACCCGCACATCGCGCACCCGCTGTTGCTGCCCCAGAACGGCCACGGGAACGCGGGCACCAC GGCCTCACCCACGGAACCGCACCACCAGGGCAGGCTGGGCTCGGCACATCCGGAGGCGCCTGCTTTGCGA GCGCCCCCTAGCGGCAGCCTCGGACCGGTGCTCCCTGTGGTCACCTCCGCCTCCAAACTGTCGCCGCCTC TGCTCTCCTCAGTGGCCTCCCTGTCGGCCTTCCCCTTCTCTTTCGGCTCCTTCCACTTACTGTCTCCCAA TGCACTGAGCCCTTCAGCACCCACGCAGGCTGCAAACCTTGGCAAGCCCTATAGACCTTGGGGGACGGAG ATCGGAGCTTTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282851 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282851.1, NP_001269780.1 |
RefSeq Size | 2052 bp |
RefSeq ORF | 645 bp |
Locus ID | 23462 |
UniProt ID | Q9Y5J3 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a nuclear protein belonging to the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcriptional repressors. Expression of this gene is induced by the Notch and c-Jun signal transduction pathways. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate 5' structure which results in the use of a downstream start codon compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236620 | HEY1 (myc-DDK-tagged) - Human hes-related family bHLH transcription factor with YRPW motif 1 (HEY1), transcript variant 3 |
CNY 3,990.00 |
|
RG236620 | HEY1 (tGFP-tagged) - Human hes-related family bHLH transcription factor with YRPW motif 1 (HEY1), transcript variant 3 |
CNY 4,370.00 |