Sigma1 receptor (SIGMAR1) (NM_001282207) Human Untagged Clone
CAT#: SC334428
SIGMAR1 (untagged) - Human sigma non-opioid intracellular receptor 1 (SIGMAR1), transcript variant 8
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALS16; DSMA2; hSigmaR1; OPRS1; SIG-1R; sigma1R; SR-BP; SR-BP1; SRBP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282207, the custom clone sequence may differ by one or more nucleotides
ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTCGCAGCGGTGCTGACCC AGGTCGTCTGGCTCTGGCTGGGGCTGGACCACGAGCTGGCCTTCTCTCGTCTGATCGTGGAGCTGCGGCG GCTGCACCCAGGCCACGTGCTGCCCGACGAGGAGCTGCAGTGGGTGTTCGTGAATGCGGGTGGCTGGATG GGCGCCATGTGCCTTCTGCACGCCTCGCTGTCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGCTCCC GCGGCCACTCGGGGCGCTACTGGGCTGAGATCTCGGATACCATCATCTCTGGCACCTTCCACCAGTGGAG AGAGGGCACCACCAAAAGTGAGGTCTTCTACCCAGGGGAGACGGTAGTACACGGGCCTGGTGAGGCAACA GCTGTGGAGTGGGGGCCAAACACATGGATGGTGGAGTACGGCCGGGGCGTCATCCCATCCACCCTGGCCT TCGCGCTGGCCGACACTGTCTTCAGCACCCAGGACTTCCTCACCCTCTTCTATACTCTTCGCTCCTATGC TCGGGGCCTCCGGCTTGAGCTCACCACCTACCTCTTTGGCCAGGACCCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282207 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282207.1, NP_001269136.1 |
RefSeq Size | 1668 bp |
RefSeq ORF | 612 bp |
Locus ID | 10280 |
UniProt ID | Q99720 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (8) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (8) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它SIGMAR1产品
Customer
Reviews
Loading...