RAB30 (NM_001286060) Human Untagged Clone

CAT#: SC334426

RAB30 (untagged) - Human RAB30, member RAS oncogene family (RAB30), transcript variant 3



  "NM_001286060" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RAB30 mouse monoclonal antibody, clone OTI3E7 (formerly 3E7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001286060, the custom clone sequence may differ by one or more nucleotides


ATGAGTATGGAAGATTATGATTTCCTGTTCAAAATTGTTTTAATTGGCAACGCTGGTGTGGGGAAGACGT
GCCTCGTCCGAAGATTCACTCAGGGTCTTTTCCCCCCAGGTCAAGGAGCCACAATTGGAGTTGATTTTAT
GATTAAGACAGTGGAGATTAATGGTGAAAAAGTAAAGCTACAGATCTGGGACACAGCAGGTCAAGAGAGA
TTTCGGTCCATTACCCAGAGTTACTACCGAAGCGCCAATGCCTTGATCCTCACCTATGACATTACCTGTG
AGGAATCCTTCCGTTGCCTTCCTGAGTGGCTGCGGGAGATAGAACAATATGCCAGCAACAAGGTCATCAC
TGTGTTAGTGGGCAACAAGATTGACCTGGCTGAAAGGAGAGAGGTTTCCCAGCAGCGAGCTGAAGAATTC
TCAGAAGCTCAGGACATGTATTATCTGGAGACCTCAGCCAAGGAATCTGATAATGTGGAGAAACTCTTCC
TTGACTTAGCATGCCGACTCATCAGTGAAGCCAGACAGAACACACTTGTGAACAATGTATCCTCACCCTT
ACCTGGAGAAGGGAAAAGCATCAGCTATTTGACTTGTTGTAATTTCAACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286060
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286060.1, NP_001272989.1
RefSeq Size 9885 bp
RefSeq ORF 612 bp
Locus ID 27314
UniProt ID Q15771
Protein Families Druggable Genome
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion (By similarity). Required for maintaining the structural integrity of the Golgi apparatus, possibly by mediating interactions with cytoplasmic scaffolding proteins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...