HMG4 (HMGB3) (NM_001301228) Human Untagged Clone

CAT#: SC334410

HMGB3 (untagged) - Human high mobility group box 3 (HMGB3), transcript variant 1



  "NM_001301228" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-HMGB3 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HMG-2a; HMG-4; HMG2A; HMG4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301228, the custom clone sequence may differ by one or more nucleotides


ATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAAGATGTCCGCTTATGCCTTCTTTGTGCAGACATGCA
GAGAAGAACATAAGAAGAAAAACCCAGAGGTCCCTGTCAATTTTGCGGAATTTTCCAAGAAGTGCTCTGA
GAGGTGGAAGACGATGTCCGGGAAAGAGAAATCTAAATTTGATGAAATGGCAAAGGCAGATAAAGTGCGC
TATGATCGGGAAATGAAGGATTATGGACCAGCTAAGGGAGGCAAGAAGAAGAAGGATCCTAATGCTCCCA
AAAGGCCACCGTCTGGATTCTTCCTGTTCTGTTCAGAATTCCGCCCCAAGATCAAATCCACAAACCCCGG
CATCTCTATTGGAGACGTGGCAAAAAAGCTGGGTGAGATGTGGAATAATTTAAATGACAGTGAAAAGCAG
CCTTACATCACTAAGGCGGCAAAGCTGAAGGAGAAGTATGAGAAGGATGTTGCTGACTATAAGTCGAAAG
GAAAGTTTGATGGTGCAAAGGGTCCTGCTAAAGTTGCCCGGAAAAAGGTGGAAGAGGAAGATGAAGAAGA
GGAGGAGGAAGAAGAGGAGGAGGAGGAGGAGGAGGATGAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001301228
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301228.1, NP_001288157.1
RefSeq Size 3676 bp
RefSeq ORF 603 bp
Locus ID 3149
UniProt ID O15347
Protein Families Transcription Factors
Gene Summary This gene encodes a member of a family of proteins containing one or more high mobility group DNA-binding motifs. The encoded protein plays an important role in maintaining stem cell populations, and may be aberrantly expressed in tumor cells. A mutation in this gene was associated with microphthalmia, syndromic 13. There are numerous pseudogenes of this gene on multiple chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the shorter isoform (a). Variants 1, 2, and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...