Phospholipase C beta 2 (PLCB2) (NM_001284299) Human Untagged Clone

CAT#: SC334408

PLCB2 (untagged) - Human phospholipase C, beta 2 (PLCB2), transcript variant 4



  "NM_001284299" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal PLCB2 Antibody (N-term)
    • 400 ul

CNY 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PLC-beta-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284299, the custom clone sequence may differ by one or more nucleotides


ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGGGAGCGCTTCA
TCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTGGATCCTAAGGGCTACTACTT
ATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGATATCACCAGCATCCGGGATACTCGCTTTGGG
AAGTTTGCCAAGATGCCCAAGAGCCAGAAGCTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTT
TCCTGCTGAAGACACTCACGGTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTC
CTACAAGGAGAACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAACTCTGAAGGGA
AGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGGGTGGAAGCTGCTCTCAGTGC
CTGCCACCTCCCCAAAGGCAAACCTGGAGGAGCGAGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001284299
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284299.1, NP_001271228.1
RefSeq Size 1840 bp
RefSeq ORF 600 bp
Locus ID 5330
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Calcium signaling pathway, Chemokine signaling pathway, Gap junction, GnRH signaling pathway, Huntington's disease, Inositol phosphate metabolism, Long-term depression, Long-term potentiation, Melanogenesis, Metabolic pathways, Phosphatidylinositol signaling system, Taste transduction, Vascular smooth muscle contraction, Wnt signaling pathway
Gene Summary The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (4) lacks multiple 3' coding exons and contains an alternate 3' terminal exon, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...