STOM (NM_001270526) Human Untagged Clone
CAT#: SC334381
STOM (untagged) - Human stomatin (STOM), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BND7; EPB7; EPB72 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001270526, the custom clone sequence may differ by one or more nucleotides
ATGGCCGAGAAGCGGCACACACGGGACTCCGAAGCCCAGCGGCTCCCCGACTCCTTCAAGGACAGCCCCA GTAAGGGCCTTGGACCTTGCGGATGGATTTTGGTGGCGTTCTCATTCTTATTCACCGTTATAACTTTCCC AATCTCAATATGGATGTGCATAAAGATTATAAAAGAGTATGAAAGAGCCATCATCTTTAGATTGGGTCGC ATTTTACAAGGAGGAGCCAAAGGACCTGGTTTGTTTTTTATTCTGCCATGCACTGACAGCTTCATCAAAG TGGACATGAGAACTATTTCATTTGATATTCCTCCTCAGGAGATCCTCACAAAGGATTCAGTGACAATTAG CGTGGATGGTGTGGTCTATTACCGCGTTCAGAATGCAACCCTGGCTGTGGCAAATATCACCAACGCTGAC TCAGCAACCCGTCTTTTGGCACAAACTACTCTGAGGAATGTTCTGGGCACCAAGAATCTTTCTCAGATCC TCTCTGACAGAGAAGAAATTGCACACAACATGCAGTCTACTCTGGATGATGCCACTGATGCCTGGGGAAT AAAGGTGGAGCGTGTGGAAATTAAGGATAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270526 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270526.1, NP_001257455.1 |
RefSeq Size | 3107 bp |
RefSeq ORF | 594 bp |
Locus ID | 2040 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of a highly conserved family of integral membrane proteins. The encoded protein localizes to the cell membrane of red blood cells and other cell types, where it may regulate ion channels and transporters. Loss of localization of the encoded protein is associated with hereditary stomatocytosis, a form of hemolytic anemia. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (3) uses two alternate splice sites in the 3' coding region, which result in a frameshift, compared to variant 1. The encoded isoform (c) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...