MICA (NM_001289154) Human Untagged Clone
CAT#: SC334367
MICA (untagged) - Human MHC class I polypeptide-related sequence A (MICA), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
MICA mouse monoclonal antibody, clone OTI2C3
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MIC-A; PERB11.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289154, the custom clone sequence may differ by one or more nucleotides
ATGGGACAGAGAGACCAGGGACTTGACAGGGAACGGAAAGGACCTCAGGATGACCCTGGCTCATATCAAG GACCAGAAAGAAGGAATTTCTTGAAGGAAGATGCCATGAAGACCAAGACACACTATCACGCTATGCATGC AGACTGCCTGCAGGAACTACGGCGATATCTAGAATCCGGCGTAGTCCTGAGGAGAACAGTGCCCCCCATG GTGAATGTCACCCGCAGCGAGGCCTCAGAGGGCAACATCACCGTGACATGCAGGGCTTCCAGCTTCTATC CCCGGAATATCATACTGACCTGGCGTCAGGATGGGGTATCTTTGAGCCACGACACCCAGCAGTGGGGGGA TGTCCTGCCTGATGGGAATGGAACCTACCAGACCTGGGTGGCCACCAGGATTTGCCGAGGAGAGGAGCAG AGGTTCACCTGCTACATGGAACACAGCGGGAATCACAGCACTCACCCTGTGCCCTCTGGGAAAGTGCTGG TGCTTCAGAGTCATTGGCAGACATTCCATGTTTCTGCTGTTGCTGCTGGCTGCTGCTATTTTTGTTATTA TTATTTTCTATGTCCGTTGTTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289154 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289154.1, NP_001276083.1 |
RefSeq Size | 2086 bp |
RefSeq ORF | 585 bp |
Locus ID | 100507436 |
Gene Summary | This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (4) contains an alternate 5' exon and uses an alternate splice site in an internal exon, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from an alternate start codon, compared to variant 1 (MICA*00801 allele). The encoded isoform (4) has a distinct and shorter N-terminus, compared to isoform 2. This RefSeq represents the MICA*00801 allelic form of variant 4; the MICA*00801 allele is found in the primary, ALT_REF_LOCI_2 and ALT_REF_LOCI_7 assembly units of the GRCh38 reference genome sequence. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...