CKAP1 (TBCB) (NM_001300971) Human Untagged Clone

CAT#: SC334354

TBCB (untagged) - Human tubulin folding cofactor B (TBCB), transcript variant 2



  "NM_001300971" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal antibody to CKAP1 (tubulin folding cofactor B)
    • 100 ul

CNY 6,281.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CG22; CKAP1; CKAPI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300971, the custom clone sequence may differ by one or more nucleotides


ATGGAACTGGAGCTGTATGGAGTTGACGACAAGTTCTACAGCAAGCTGGATCAAGAGGATGCGCTCCTGG
GCTCCTACCCTGTAGATGACGGCTGCCGCATCCACGTCATTGACCACAGTGGCGCCCGCCTTGGTGAGTA
TGAGGACGTGTCCCGGGTGGAGAAGTACACGATCTCACAAGAAGCCTACGACCAGAGGCAAGACACGGTC
CGCTCTTTCCTGAAGCGCAGCAAGCTCGGCCGGTACAACGAGGAGGAGCGGGCTCAGCAGGAGGCCGAGG
CCGCCCAGCGCCTGGCCGAGGAGAAGGCCCAGGCCAGCTCCATCCCCGTGGGCAGCCGCTGTGAGGTGCG
GGCGGCGGGACAATCCCCTCGCCGGGGCACCGTCATGTATGTAGGTCTCACAGATTTCAAGCCTGGCTAC
TGGATTGGTGTCCGCTATGATGAGCCACTGGGGAAAAATGATGGCAGTGTGAATGGGAAACGCTACTTCG
AATGCCAGGCCAAGTATGGCGCCTTTGTCAAGCCAGCAGTCGTGACGGTGGGGGACTTCCCGGAGGAGGA
CTACGGGTTGGACGAGATATGA


Restriction Sites SgfI-MluI     
ACCN NM_001300971
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300971.1, NP_001287900.1
RefSeq Size 900 bp
RefSeq ORF 582 bp
Locus ID 1155
UniProt ID Q99426
Gene Summary Binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway leading from newly synthesized tubulin to properly folded heterodimer (PubMed:9265649). Involved in regulation of tubulin heterodimer dissociation. May function as a negative regulator of axonal growth (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...