CKAP1 (TBCB) (NM_001300971) Human Untagged Clone
CAT#: SC334354
TBCB (untagged) - Human tubulin folding cofactor B (TBCB), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CG22; CKAP1; CKAPI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300971, the custom clone sequence may differ by one or more nucleotides
ATGGAACTGGAGCTGTATGGAGTTGACGACAAGTTCTACAGCAAGCTGGATCAAGAGGATGCGCTCCTGG GCTCCTACCCTGTAGATGACGGCTGCCGCATCCACGTCATTGACCACAGTGGCGCCCGCCTTGGTGAGTA TGAGGACGTGTCCCGGGTGGAGAAGTACACGATCTCACAAGAAGCCTACGACCAGAGGCAAGACACGGTC CGCTCTTTCCTGAAGCGCAGCAAGCTCGGCCGGTACAACGAGGAGGAGCGGGCTCAGCAGGAGGCCGAGG CCGCCCAGCGCCTGGCCGAGGAGAAGGCCCAGGCCAGCTCCATCCCCGTGGGCAGCCGCTGTGAGGTGCG GGCGGCGGGACAATCCCCTCGCCGGGGCACCGTCATGTATGTAGGTCTCACAGATTTCAAGCCTGGCTAC TGGATTGGTGTCCGCTATGATGAGCCACTGGGGAAAAATGATGGCAGTGTGAATGGGAAACGCTACTTCG AATGCCAGGCCAAGTATGGCGCCTTTGTCAAGCCAGCAGTCGTGACGGTGGGGGACTTCCCGGAGGAGGA CTACGGGTTGGACGAGATATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300971 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001300971.1, NP_001287900.1 |
RefSeq Size | 900 bp |
RefSeq ORF | 582 bp |
Locus ID | 1155 |
UniProt ID | Q99426 |
Gene Summary | Binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway leading from newly synthesized tubulin to properly folded heterodimer (PubMed:9265649). Involved in regulation of tubulin heterodimer dissociation. May function as a negative regulator of axonal growth (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...