Endothelin 3 (EDN3) (NM_001302456) Human Untagged Clone

CAT#: SC334347

EDN3 (untagged) - Human endothelin 3 (EDN3), transcript variant 6



  "NM_001302456" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-EDN3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ET-3; ET3; HSCR4; PPET3; WS4B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302456, the custom clone sequence may differ by one or more nucleotides


ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGACCTCCGCCGCAGGATTCGTGCCTTGCTCCC
AGTCTGGGGATGCTGGCAGGCGCGGCGTGTCCCAGGCCCCCACTGCAGCCAGATCTGAGGGGGACTGTGA
AGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGCCCTGGCGAGGGGACTGTGGCCCCGACAGCA
CTGCAGGGTCCAAGCCCTGGAAGCCCTGGGCAGGAGCAGGCGGCCGAGGGGGCCCCTGAGCACCACCGAT
CCAGGCGCTGCACGTGCTTCACCTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATTTG
GATCAACACTCCCGAACAGACGGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGCAAGAGG
TCTGCGGGGCCACTTCCAGGGAATCTGCAGCTCTCACATCGGCCACACTTGCGCTGCGCTTGTGTGGGGA
GATATGACAAGGCCTGCCTGCACTTTTGCACCCAAACTCTGGACGTCAGCAGGTTGAAGTCAAGGACCAA
CAAAGCAAGCAGGCTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001302456
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302456.1, NP_001289385.1
RefSeq Size 2630 bp
RefSeq ORF 579 bp
Locus ID 1908
UniProt ID P14138
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (6) lacks an exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 4. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...