Centrin 3 (CETN3) (NM_001297765) Human Untagged Clone

CAT#: SC334330

CETN3 (untagged) - Human centrin, EF-hand protein, 3 (CETN3), transcript variant 1



  "NM_001297765" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CETN3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDC31; CEN3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297765, the custom clone sequence may differ by one or more nucleotides


ATGAGTTTAGCTCTGAGAAGTGAGCTTGTAGTGGACAAAACAAAGAGGAAAAAAAGAAGAGAACTGTCTG
AGGAACAGAAACAAGAAATTAAAGATGCTTTTGAACTATTTGATACAGACAAAGATGAAGCAATAGATTA
TCATGAATTAAAGGTGGCAATGAGAGCCTTGGGGTTTGATGTAAAAAAAGCTGATGTACTGAAGATTCTT
AAAGATTATGACAGAGAAGCCACAGGGAAAATCACCTTTGAAGATTTTAATGAAGTTGTGACAGACTGGA
TATTGGAAAGAGATCCCCATGAAGAAATACTCAAGGCATTTAAACTATTTGATGATGATGATTCAGGTAA
AATAAGCTTGAGGAATTTGCGACGTGTTGCTAGAGAATTGGGTGAAAACATGAGTGATGAAGAACTTCGA
GCTATGATAGAAGAATTTGACAAAGATGGTGATGGAGAAATTCTTAAGAACATACTCTTGCTTCCTATTT
GGTCTAGATGCCTCAGTCTAAATCGGGAGTTCTTCAGTGAAGTAAACCAAGAGGAGTTCATTGCTATTAT
GACTGGTGACATTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001297765
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297765.1, NP_001284694.1
RefSeq Size 1446 bp
RefSeq ORF 576 bp
Locus ID 1070
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...