EIF4EL3 (EIF4E2) (NM_001276337) Human Untagged Clone

CAT#: SC334314

EIF4E2 (untagged) - Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), transcript variant 4



  "NM_001276337" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
EIF4E2 mouse monoclonal antibody, clone OTI1F11 (formerly 1F11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001276337, the custom clone sequence may differ by one or more nucleotides


ATGAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGACCATGATCAGAATGAAGAAAACAGCA
CACAGAAAGATGGTGAGAAGGAAAAAACGGAACGAGACAAGAATCAGAGCAGTAGCAAGAGAAAGGTGGA
GCAGTTCTGGAGGTTTTATAGCCACATGGTACGTCCTGGGGACCTGACAGGCCACAGTGACTTCCATCTC
TTCAAAGAAGGAATTAAACCCATGTGGGAGGATGATGCAAATAAAAATGGTGGCAAGTGGATTATTCGGC
TGCGGAAGGGCTTGGCCTCCCGTTGCTGGGAGAATCTCATTTTGGCCATGCTGGGGGAACAGTTCATGGT
TGGGGAGGAGATCTGTGGGGCTGTGGTGTCTGTCCGCTTTCAGGAAGACATTATTTCAATATGGAATAAG
ACTGCCAGTGACCAAGCAACCACAGCCCGAATCCGGGACACACTTCGGCGAGTGCTTAACCTACCTCCCA
ACACCATTATGGAATACAAAACTCACACCGACAGCATCAAGGACAATTCAAGCTTTCGAAATACAAAAAT
CACATTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001276337
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276337.1, NP_001263266.1
RefSeq Size 3416 bp
RefSeq ORF 570 bp
Locus ID 9470
Protein Families Transcription Factors
Protein Pathways Insulin signaling pathway, mTOR signaling pathway
Gene Summary Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:9582349, PubMed:17368478, PubMed:25624349). Acts as a repressor of translation initiation (PubMed:22751931). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 5' coding region, and uses an alternate 3' terminal exon and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (D) has a distinct C-terminus and is shorter than isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...