ICOS Ligand (ICOSLG) (NM_001283051) Human Untagged Clone
CAT#: SC334272
ICOSLG (untagged) - Human inducible T-cell co-stimulator ligand (ICOSLG), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
ICOSLG mouse monoclonal antibody, clone OTI2C5 (formerly 2C5)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B7-H2; B7h; B7H2; B7RP-1; B7RP1; CD275; GL50; ICOS-L; ICOSL; LICOS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001283051, the custom clone sequence may differ by one or more nucleotides
ATGCGGCTGGGCAGTCCTGGACTGCTCTTCCTGCTCTTCAGCAGCCTTCGAGCTGCAAACTTCAGCGTGC CCGTCGTCAGCGCCCCCCACAGCCCCTCCCAGGATGAGCTCACCTTCACGTGTACATCCATAAACGGCTA CCCCAGGCCCAACGTGTACTGGATCAATAAGACGGACAACAGCCTGCTGGACCAGGCTCTGCAGAATGAC ACCGTCTTCTTGAACATGCGGGGCTTGTATGACGTGGTCAGCGTGCTGAGGATCGCACGGACCCCCAGCG TGAACATTGGCTGCTGCATAGAGAACGTGCTTCTGCAGCAGAACCTGACTGTCGGCAGCCAGACAGGAAA TGACATCGGAGAGAGAGACAAGATCACAGAGAATCCAGTCAGTACCGGCGAGAAAAACGCGGCCACGTGG AGCATCCTGGCTGTCCTGTGCCTGCTTGTGGTCGTGGCGGTGGCCATAGGCTGGGTGTGCAGGGACCGAT GCCTCCAACACAGCTATGCAGGTGCCTGGGCTGTGAGTCCGGAGACAGAGCTCACTGGCCACGTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001283051 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001283051.1, NP_001269980.1 |
RefSeq Size | 2969 bp |
RefSeq ORF | 558 bp |
Locus ID | 23308 |
UniProt ID | O75144 |
Protein Families | Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs) |
Gene Summary | Ligand for the T-cell-specific cell surface receptor ICOS. Acts as a costimulatory signal for T-cell proliferation and cytokine secretion; induces also B-cell proliferation and differentiation into plasma cells. Could play an important role in mediating local tissue responses to inflammatory conditions, as well as in modulating the secondary immune response by co-stimulating memory T-cell function (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (c) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它ICOS Ligand产品
Customer
Reviews
Loading...