RXYLT1 (NM_001278237) Human Untagged Clone
CAT#: SC334257
TMEM5 (untagged) - Human transmembrane protein 5 (TMEM5), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HP10481; MDDGA10; TMEM5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278237, the custom clone sequence may differ by one or more nucleotides
ATGCTGCATGATGAGAGGCCATATTTATGTAATTTCTTAGGAACGATTTATGAAAATTCATCCAGACAGG CACTAATGAACATTTTGAAAAAAGATGGGAACGATAAGCTTTGTTGGGTTTCAGCAAGAGAACACTGGCA GCCTCAGGAAACAAATGAAAGTCTTAAGAATTACCAAGATGCCTTGCTTCAGAGTGATCTCACATTGTGC CCGGTCGGAGTAAACACAGAATGCTATCGAATCTATGAGGCTTGCTCCTATGGCTCCATTCCTGTGGTGG AAGACGTGATGACAGCTGGCAACTGTGGGAATACATCTGTGCACCACGGTGCTCCTCTGCAGTTACTCAA GTCCATGGGTGCTCCCTTTATCTTTATCAAGAACTGGAAGGAACTCCCTGCTGTTTTAGAAAAAGAGAAA ACTATAATTTTACAAGAAAAAATTGAAAGAAGAAAAATGTTACTTCAGTGGTATCAGCACTTCAAGACAG AGCTTAAAATGAAATTTACTAATATTTTAGAAAGCTCATTTTTAATGAATAATAAAAGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278237 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278237.1, NP_001265166.1 |
RefSeq Size | 1973 bp |
RefSeq ORF | 552 bp |
Locus ID | 10329 |
UniProt ID | Q9Y2B1 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a type II transmembrane protein that is thought to have glycosyltransferase function. Mutations in this gene result in cobblestone lissencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...