RAG1AP1 (SLC50A1) (NM_001287591) Human Untagged Clone
CAT#: SC334256
SLC50A1 (untagged) - Human solute carrier family 50 (sugar efflux transporter), member 1 (SLC50A1), transcript variant 9
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HsSWEET1; RAG1AP1; SCP; slv; SWEET1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287591, the custom clone sequence may differ by one or more nucleotides
ATGCGAATGACCCGGAGTGTGGACAACGTCCAGTTCCTGCCCTTTCTCACCACGGAAGTCAACAACCTGG GCTGGCTGAGTTATGGGGCTTTGAAGGGAGACGGGATCCTCATCGTCGTCAACACAGTGGGTGCTGCGCT TCAGACCCTGTATATCTTGGCATATCTGCATTACTGCCCTCGGAAGACTGCAACCCTGCTAGGGGTCCTT CTCCTGGGTTATGGCTACTTTTGGCTCCTGGTACCCAACCCTGAGGCCCGGCTTCAGCAGTTGGGCCTCT TCTGCAGTGTCTTCACCATCAGCATGTACCTCTCACCACTGGCTGACTTGGCTAAGGTGATTCAAACTAA ATCAACCCAATGTCTCTCCTACCCACTCACCATTGCTACCCTTCTCACCTCTGCCTCCTGGTGCCTCTAT GGGTTTCGACTCAGAGATCCCTATATCATGGTGTCCAACTTTCCAGGAATCGTCACCAGCTTTATCCGCT TCTGGCTTTTCTGGAAGTACCCCCAGGAGCAAGACAGGAACTACTGGCTCCTGCAAACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287591 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287591.1, NP_001274520.1 |
RefSeq Size | 1420 bp |
RefSeq ORF | 552 bp |
Locus ID | 55974 |
UniProt ID | Q9BRV3 |
Protein Families | Transmembrane |
Gene Summary | Mediates sugar transport across membranes. May stimulate V(D)J recombination by the activation of RAG1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (9) uses an alternate first exon and an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (i) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236362 | SLC50A1 (myc-DDK-tagged) - Human solute carrier family 50 (sugar efflux transporter), member 1 (SLC50A1), transcript variant 9 |
CNY 3,990.00 |
|
RG236362 | SLC50A1 (tGFP-tagged) - Human solute carrier family 50 (sugar efflux transporter), member 1 (SLC50A1), transcript variant 9 |
CNY 4,370.00 |
其它SLC50A1产品