KLRF1 (NM_001291822) Human Untagged Clone

CAT#: SC334234

KLRF1 (untagged) - Human killer cell lectin-like receptor subfamily F, member 1 (KLRF1), transcript variant KLRF1-s



  "NM_001291822" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KLRF1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLEC5C; NKp80
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291822, the custom clone sequence may differ by one or more nucleotides


ATGCAAGATGAAGAAAGATACATGACATTGAATGTACAGTCAAAGAAAAGGAGTTCTGCCCAAACATCTC
AACTTACATTTAAAGATTATTCAGTGACGTTGCACTGGTATAAAATCTTACTGGGAATATCTGGAACCGT
GAATGGTATTCTCACTTTGACTTTGATCTCCTTGATCCTGTTGGTACTATGCCAATCAGAATGGCTCAAA
TACCAAGGGAAGTGTTATTGGTTCTCTAATGAGATGAAAAGCTGGAGTGACAGTTATGTGTATTGTTTGG
AAAGAAAATCTCATCTACTAATCATACATGACCAACTTGAAATGGCTTTTATACAGAAAAACCTAAGACA
ATTAAACTACGTATGGATTGGGCTTAACTTTACCTCCTTGAAAATGACATGGACTTGGGTGGATGGTTCT
CCAATAGATTCAAAGATATTCTTCATAAAGGGACCAGCTAAAGAAAACAGCTGTGCTGCCATTAAGGAAA
GCAAAATTTTCTCTGAAACCTGCAGCAGTGTTTTCAAATGGATTTGTCAGTATTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291822
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291822.1, NP_001278751.1
RefSeq Size 1116 bp
RefSeq ORF 546 bp
Locus ID 51348
UniProt ID Q9NZS2
Protein Families Transmembrane
Gene Summary KLRF1, an activating homodimeric C-type lectin-like receptor (CTLR), is expressed on nearly all natural killer (NK) cells and stimulates their cytoxicity and cytokine release (Kuttruff et al., 2009 [PubMed 18922855]).[supplied by OMIM, Oct 2009]
Transcript Variant: This variant (KLRF1-s) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (KLRF1-s) that is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...