Lysophospholipase 1 (LYPLA1) (NM_001279359) Human Untagged Clone
CAT#: SC334227
LYPLA1 (untagged) - Human lysophospholipase I (LYPLA1), transcript variant 5
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APT-1; APT1; hAPT1; LPL-I; LPL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001279359, the custom clone sequence may differ by one or more nucleotides
ATGGGCAGAAGCCTTTGCAGGCCTGTTAGGCCTGTTACATTAAATATGAACGTGGCTATGCCTTCATGGT TTGATATTATTGGGCTTTCACCAGATTCACAGGAGGATGAATCTGGGATTAAACAGGCAGCAGAAAATAT AAAAGCTTTGATTGATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTGGGAGGGTTTTCT CAGGGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAGAAACTGGCAGGTGTCACTGCACTCA GTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCTATCGGTGGTGCTAATAGAGATATTTCTAT TCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATGTTTGGTTCTCTTACGGTGGAAAAACTA AAAACATTGGTGAATCCAGCCAATGTGACCTTTAAAACCTATGAAGGTATGATGCACAGTTCGTGTCAAC AGGAAATGATGGATGTCAAGCAATTCATTGATAAACTCCTACCTCCAATTGATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001279359 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001279359.1, NP_001266288.1 |
RefSeq Size | 2556 bp |
RefSeq ORF | 546 bp |
Locus ID | 10434 |
UniProt ID | O75608 |
Protein Pathways | Glycerophospholipid metabolism |
Gene Summary | This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (5) uses an alternate splice site in its 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (5) has a shorter and distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Lysophospholipase 1产品
Customer
Reviews
Loading...