GAS41 (YEATS4) (NM_001300950) Human Untagged Clone
CAT#: SC334168
YEATS4 (untagged) - Human YEATS domain containing 4 (YEATS4), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 4930573H17Rik; B230215M10Rik; GAS41; NUBI-1; YAF9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300950, the custom clone sequence may differ by one or more nucleotides
ATGTTCAAGAGAATGGCCGAATTTGGGCCTGACTCCGGCGGGAGAGTAAAGGGTGTTACTATCGTTAAAC CAATAGTTTACGGTAATGTTGCTCGGTATTTTGGAAAGAAAAGAGAAGAAGATGGGCACACTCATCAGTG GACAGTATATGTGAAACCATATAGAAATGAGGTAACCCTGTATCATTTGCTAAAGCTGTTTCAATCAGAC ACCAATGCAATGCTGGGGAAAAAGACAGTGGTTTCAGAGTTCTATGATGAAATGATATTTCAAGACCCAA CAGCAATGATGCAACAATTATTGACAACATCTCGTCAGCTAACATTAGGAGCCTATAAGCATGAAACAGA ATTTGCAGAGCTTGAAGTGAAAACCAGAGAAAAATTAGAAGCTGCTAAGAAAAAAACAAGCTTTGAGATT GCAGAGCTTAAGGAGAGATTAAAAGCAAGTCGTGAAACTATAAATTGTTTAAAAAATGAAATCAGAAAAC TTGAAGAAGATGACCAAGCAAAAGACATATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300950 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300950.1, NP_001287879.1 |
RefSeq Size | 1347 bp |
RefSeq ORF | 522 bp |
Locus ID | 8089 |
UniProt ID | O95619 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The protein encoded by this gene is found in the nucleoli. It has high sequence homology to human MLLT1, and yeast and human MLLT3 proteins. Both MLLT1 and MLLT3 proteins belong to a class of transcription factors, indicating that the encoded protein might also represent a transcription factor. This protein is thought to be required for RNA transcription. This gene has been shown to be amplified in tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks two in-frame exons in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...