TNFAIP8 (NM_001286815) Human Untagged Clone

CAT#: SC334104

TNFAIP8 (untagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 5



  "NM_001286815" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TNFAIP8 mouse monoclonal antibody,clone OTI1H9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334104 representing NM_001286815.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGTCCAAATCCATCGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTAC
AGAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACA
GTCATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAA
TTTAAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGAC
CGGAATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTC
ACTGCCAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCC
TTGTATAATCCTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGATGGTATCAACAAAATGTTG
GATGAAGAGAACATATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286815
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286815.1
RefSeq Size 2135 bp
RefSeq ORF 501 bp
Locus ID 25816
UniProt ID O95379
Protein Families Druggable Genome
MW 19.5 kDa
Gene Summary Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (d) has a shorter N-terminus, compared to isoform a. Both variants 5 and 6 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...