ISG20 (NM_001303237) Human Untagged Clone

CAT#: SC334077

ISG20 (untagged) - Human interferon stimulated exonuclease gene 20kDa (ISG20), transcript variant 6



  "NM_001303237" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ISG20 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD25; HEM45
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334077 representing NM_001303237.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGGGAGCCGTGAGGTGGTGGCCATGGACTGCGAGATGGTGGGGCTGGGGCCCCACCGGGAGAGT
GGCCTGGCTCGTTGCAGCCTCGTGAACGTCCACGGTGCTGTGCTGTACGACAAGTTCATCCGGCCTGAG
GGAGAGATCACCGATTACAGAACCCGGGTCAGCGGGGTCACCCCTCAGCACATGGTGGGGGCCACACCA
TTTGCCGTGGCCAGGCTAGAGGCACTGAAAGAGGACATGAGCGGCTACACAATCTACGACACGTCCACT
GACAGGCTGTTGTGGCGTGAGGCCAAGCTGGACCACTGCAGGCGTGTCTCCCTGCGGGTGCTGAGTGAG
CGCCTCCTACACAAGAGCATCCAGAACAGCCTGCTTGGACACAGCTCGGTGGAAGATGCGAGGGCAACG
ATGGAGCTCTATCAAATCTCCCAGAGAATCCGAGCCCGCCGAGGGCTGCCCCGCCTGGCTGTGTCAGAC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001303237
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303237.1
RefSeq Size 1657 bp
RefSeq ORF 486 bp
Locus ID 3669
MW 18.1 kDa
Gene Summary Interferon-induced antiviral exoribonuclease that acts on single-stranded RNA and also has minor activity towards single-stranded DNA. Exhibits antiviral activity against RNA viruses including hepatitis C virus (HCV), hepatitis A virus (HAV) and yellow fever virus (YFV) in an exonuclease-dependent manner. May also play additional roles in the maturation of snRNAs and rRNAs, and in ribosome biogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) uses an alternate in-frame splice junction at the 5' end of an internal exon compared to variant 1. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...