EXOC7 (NM_001282314) Human Untagged Clone

CAT#: SC334060

EXOC7 (untagged) - Human exocyst complex component 7 (EXOC7), transcript variant 7



  "NM_001282314" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Polyclonal Antibody against EXOC7
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2-5-3p; BLOM4; EX070; EXO70; Exo70p; EXOC1; NEDSEBA; YJL085W
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334060 representing NM_001282314.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTCCCCCACAGGAGGCATCCGCTCGACGGCGGGAGATTGAGGACAAGCTGAAGCAGGAGGAGGAG
ACTCTGTCCTTCATCCGAGACAGCCTGGAGAAGAGCGACCAGCTCACTAAGAACATGGTGTCTATCTTA
TCATCCTTTGAGAGCCGCCTTATGAAGCTGGAGAACTCCATCATCCCTGTGCACAAGCAGACGGAGAAT
CTGCAGCGGCTGCAGGAGAATGTTGAGAAGACGCTGTCCTGCCTGGACCATGTCATCAGCTACTACCAT
GTGGCCAGTGACACTGAGAAGATCATCAGAGAGGGCCCCACAGGTAGGCTGGAAGAGTACCTGGGAAGC
ATGGCCAAGATTCAGAAGGCAGTGGAGTATTTCCAGGACAACAGCCCAGACAGCCCGGAACTCAACAAA
GTGGTAAGGGGTCCGCAGAATAACGTGAGAAGCTTGGGGATATCAGTCTCTGCCCTGGTCTCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282314
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282314.1
RefSeq Size 771 bp
RefSeq ORF 480 bp
Locus ID 23265
Protein Families Druggable Genome
Protein Pathways Insulin signaling pathway
MW 18.1 kDa
Gene Summary The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (7) lacks several 3' exons but contains an alternate 3' structure, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (7) has a shorter and distinct C-terminus compared with isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...