PRKCBP1 (ZMYND8) (NM_001281769) Human Untagged Clone

CAT#: SC334006

ZMYND8 (untagged) - Human zinc finger, MYND-type containing 8 (ZMYND8), transcript variant 4



  "NM_001281769" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ZMYND8 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,900.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRKCBP1; PRO2893; RACK7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334006 representing NM_001281769.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATCCACAGAGCTTGGCTGAAGAGGAAATAAAAACAGAACAGGAGGTGGTAGAGGGCATGGATATC
TCTACTCGCTCCAAAGATCCTGGCTCTGCAGAGAGAACAGCCCAGAAAAGAAAGTTCCCCAGCCCTCCA
CATTCTTCCAATGGCCACTCGCCGCAGGACACATCAACAAGCCCCATTAAAAAGAAAAAGAAACCTGGC
TTACTGAACAGTAACAATAAGGAGCAGTCAGAACTAAGACATGGTCCGTTTTACTATATGAAGCAGCCA
CTCACCACAGACCCTGTTGATGTTGTACCGCAGGATGGACGGAATGATTTCTACTGCTGGGTTTGTCAC
CGGGAAGGCCAAGTCCTTTGCTGTGAGCTCTGTCCCCGGGTTTATCACGCTAAGTGTCTGAGACTGACA
TCGGAACCAGAGGGGGACTGGTTTTGTCCTGAATGTGAGGTTAGTTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001281769
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281769.1
RefSeq Size 1288 bp
RefSeq ORF 465 bp
Locus ID 23613
Protein Families Druggable Genome, Transcription Factors
MW 17.5 kDa
Gene Summary The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (d) has a shorter and distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...