RNF86 (TRIM2) (NM_001302694) Human Untagged Clone

CAT#: SC334004

TRIM2 (untagged) - Human tripartite motif containing 2 (TRIM2), transcript variant 5



  "NM_001302694" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TRIM2 mouse monoclonal antibody, clone OTI2B10 (formerly 2B10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMT2R; RNF86
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334004 representing NM_001302694.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCAGCGTGCAGGGTCAAAGACAGCCGGCCCCCCATGTCAGTGGTCTAGGATGGCCAGTGAAGGC
ACCAACATCCCAAGTCCTGTGGTGCGCCAGATTGACAAGCAGTTTCTGATTTGCAGTATATGCCTGGAA
CGGTACAAGAATCCCAAGGTTCTCCCCTGTCTGCACACTTTCTGCGAGAGGTGCCTGCAGAACTACATT
CCTGCCCACAGTTTAACCCTCTCCTGCCCAGTGTGCCGCCAGACCTCCATCCTGCCCGAGAAAGGGGTG
GCCGCGCTCCAGAACAATTTCTTCATCACAAACCTGATGGACGTGCTGCAGCGAACTCCAGGCAGCAAC
GCTGAGGAGTCTTCCATCCTGGAGACAGTCACTGCTGTGGCTGCGGGAAAGCCTCTCTCTTGCCCAAAC
CACGATGGGAATGTAAGTGGCTGGGATGGCAGATACTGCCCGGGAGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302694
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302694.1
RefSeq Size 831 bp
RefSeq ORF 465 bp
Locus ID 23321
MW 16.8 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (5) contains alternate 5' and 3' terminal exons and lacks several other 3' exons, and it thus differs in both UTRs and in the 5' and 3' coding regions, compared to variant 1. The encoded isoform (5) has distinct N- and C-termini and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...