CARHSP1 (NM_001278262) Human Untagged Clone

CAT#: SC333941

CARHSP1 (untagged) - Human calcium regulated heat stable protein 1, 24kDa (CARHSP1), transcript variant 5



  "NM_001278262" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to CRHSP-24 (calcium regulated heat stable protein 1, 24kDa)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRHSP-24; CRHSP24; CSDC1
Vector pCMV6-Entry
Sequence Data
>SC333941 representing NM_001278262.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCATCTGAGCCTCCCCCACCACCACAGCCCCCCACCCATCAAGCTTCAGTCGGGCTGCTGGACACC
CCTCGGAGCCGTGAGCGCTCACCATCCCCTCTGCGGGGCAACGTGGTCCCAAGCCCACTGCCCACTCGC
CGGACGAGGACCTTCTCGGCGACGGTGCGGGCTTCACAGGGCCCCGTCTACAAAGGAGTCTGCAAATGC
TTCTGCCGGTCCAAGGGCCATGGCTTCATTACCCCAGCTGATGGCGGCCCCGACATCTTCCTGCACATC
TCTGATGTGGAAGGGGAGTATGTCCCAGTGGAAGGCGACGAGGTCACCTATAAAATGTGCTCCATCCCA
CCCAAGAATGAGAAGCTGCAGGCCGTGGAGGTCGTCATCACTCACCTGGCACCAGGCACCAAGCATGAG
ACCTGGTCTGGACATGTCATCAGCTCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001278262
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278262.1
RefSeq Size 2949 bp
RefSeq ORF 444 bp
Locus ID 23589
UniProt ID Q9Y2V2
Protein Families Transcription Factors
MW 15.9 kDa
Gene Summary Binds mRNA and regulates the stability of target mRNA. Binds single-stranded DNA (in vitro).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...