RBM7 (NM_001286046) Human Untagged Clone

CAT#: SC333928

RBM7 (untagged) - Human RNA binding motif protein 7 (RBM7), transcript variant 3



  "NM_001286046" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RBM7 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333928 representing NM_001286046.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATAACATGACTTCATCAGCACAGATAATTCAGAGATCTTTCTCTTCTCCAGAAAATTTTCAGAGA
CAAGCAGTGATGAACAGTGCTTTGAGACAAATGTCATATGGTGGAAAATTTGGTTCTTCACCTCTGGAT
CAATCAGGATTTTCACCATCAGTTCAATCACACAGTCATAGTTTCAATCAGTCTTCAAGCTCCCAGTGG
CGCCAAGGTACACCATCATCACAGCGTAAAGTCAGAATGAATTCTTATCCCTACCTAGCAGATAGACAT
TATAGCCGGGAACAGCGTTACACTGATCATGGGTCTGACCATCATTACAGAGGAAAGAGAGATGATTTC
TTCTATGAAGACAGGAATCATGATGACTGGAGCCATGACTATGATAACAGAAGAGACAGTAGTAGAGAT
GGAAAATGGCGCTCATCTCGACACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286046
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286046.1
RefSeq Size 3746 bp
RefSeq ORF 441 bp
Locus ID 10179
UniProt ID Q9Y580
MW 17.2 kDa
Gene Summary Subunit of the trimeric nuclear exosome targeting (NEXT) complex, a complex that directs a subset of non-coding short-lived RNAs for exosomal degradation. The RNA exosome is fundamental for the degradation of RNA in eukaryotic nuclei. Substrate targeting is facilitated by its cofactor MTREX, which links to RNA-binding protein adapters (PubMed:27871484). Possible involved in germ cell RNA processing and meiosis (Probable).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) has a shorter N-terminus than isoform a. Variants 3, 4, and 5 encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...