Neuritin (NRN1) (NM_001278710) Human Untagged Clone

CAT#: SC333888

NRN1 (untagged) - Human neuritin 1 (NRN1), transcript variant 2



  "NM_001278710" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Neuritin Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ380B8.2; NRN
Vector pCMV6-Entry
Sequence Data
>SC333888 representing NM_001278710.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGACTTAAGTTGAACGGCAGATATATTTCACTGATCCTCGCGGTGCAAATAGCGTATCTGGTGCAG
GCCGTGAGAGCAGCGGGCAAGTGCGATGCGGTCTTCAAGGGCTTTTCGGACTGTTTGCTCAAGCTGGGC
GACAGCATGGCCAACTACCCGCAGGGCCTGGACGACAAGACGAACATCAAGACCGTGTGCACATACTGG
GAGGATTTCCACAGCTGCACGGTCACAGCCCTTACGGATTGCCAGGAAGGGGCGAAAGATATGTGGGAT
AAACTGAGAAAAGAATCCAAAAACCTCAACATCCAAGGCAGCTTATTCGAACTCTGCGGCAGCGGCAAC
GGGGCGGCGGGGTCCCTGCTCCCGGCGTTCCCGGTGCTCCTGGTGTCTCTCTCGGCAGCTTTAGCGACC
TGGCTTTCCTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001278710
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278710.1
RefSeq Size 1574 bp
RefSeq ORF 429 bp
Locus ID 51299
UniProt ID Q9NPD7
MW 15.3 kDa
Gene Summary This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...