Sumo 3 (SUMO3) (NM_001286416) Human Untagged Clone

CAT#: SC333883

SUMO3 (untagged) - Human small ubiquitin-like modifier 3 (SUMO3), transcript variant 2



  "NM_001286416" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-SUMO3 Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SMT3A; Smt3B; SMT3H1; SUMO-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333883 representing NM_001286416.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCGAGGAGAAGCCCAAGGAGGGTGTGAAGACAGAGAATGACCACATCAACCTGAAGGTGGCCGGG
CAGGACGGCTCCGTGGTGCAGTTCAAGATCAAGAGGCACACGCCGCTGAGCAAGCTGATGAAGGCCTAC
TGCGAGAGGCAGGTGCGGCACCTTGCTCCCCCGCAGAGCCTCCCCGTGTGCGCACTGGTCCTGTGCGTT
CCAGGCATCCCCAGAGCACGAGCGTCTCGGGGCTGGACCCAGATGCAGCTGCCCGAGGGCTTGTCAATG
AGGCAGATCAGATTCAGGTTCGACGGGCAGCCAATCAATGAAACTGACACTCCAGCACAGCTGGAGATG
GAGGACGAGGACACCATCGACGTGTTCCAGCAGCAGACGGGAGGTGTGCCGGAGAGCAGCCTGGCAGGG
CACAGTTTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286416
Insert Size 426 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286416.1
RefSeq Size 1945 bp
RefSeq ORF 426 bp
Locus ID 6612
UniProt ID P55854
Protein Families Druggable Genome
MW 15.8 kDa
Gene Summary This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site compared to variant 1. The resulting longer isoform (2) has an internal protein segment not found in isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...