NTAQ1 (NM_001283027) Human Untagged Clone

CAT#: SC333847

WDYHV1 (untagged) - Human WDYHV motif containing 1 (WDYHV1), transcript variant 3



  "NM_001283027" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-WDYHV1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C8orf32; WDYHV1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333847 representing NM_001283027.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATGCAAATGTACTTCTGAATGCGCACGATTACCATGTTGTTTTGCTTCATGTTTCAAGTGGAGGA
CAGAACTTCATTTATGATCTCGATACTGTCTTGCCATTTCCCTGCCTCTTTGACACTTATGTAGAAGAT
GCCTTTAAGTCTGATGATGACATTCACCCACAGTTTAGGAGGAAATTTAGAGTGATCCGTGCAGATTCA
TATTTGAAGAACTTTGCTTCTGACCGATCTCACATGAAAGACTCCAGTGGGAATTGGAGAGAGCCTCCG
CCGCCATATCCCTGCATTGAGACTGGAGATTCCAAAATGAACCTGAACGATTTCATCAGTATGGATCCC
AAGGTAGGATGGGGCGCCGTCTACACACTATCCGAATTTACACATCGGTTTGGCAGTAAAAACTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001283027
Insert Size 414 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001283027.1
RefSeq Size 1593 bp
RefSeq ORF 414 bp
Locus ID 55093
Protein Families Stem cell - Pluripotency
MW 15.8 kDa
Gene Summary Mediates the side-chain deamidation of N-terminal glutamine residues to glutamate, an important step in N-end rule pathway of protein degradation. Conversion of the resulting N-terminal glutamine to glutamate renders the protein susceptible to arginylation, polyubiquitination and degradation as specified by the N-end rule. Does not act on substrates with internal or C-terminal glutamine and does not act on non-glutamine residues in any position. Does not deaminate acetylated N-terminal glutamine. With the exception of proline, all tested second-position residues on substrate peptides do not greatly influence the activity. In contrast, a proline at position 2, virtually abolishes deamidation of N-terminal glutamine.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and has an alternate internal exon compared to variant 1. These differences cause translation initiation at a alternate start codon compared to variant 1. The encoded isoform (3) is shorter and has a disntinct N-teminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...