ZNF302 (NM_018675) Human Untagged Clone

CAT#: SC333796

ZNF302 (untagged) - Human zinc finger protein 302 (ZNF302), transcript variant 15



  "NM_018675" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ZNF302 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSD16; MST154; MSTP154; ZNF135L; ZNF140L; ZNF327
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333796 representing NM_018675.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCAGGTGACATTTAGTGATGTGGCTATAGACTTCTCTCATGAAGAGTGGGCATGCCTAGATTCT
GCTCAGAGGGACTTATACAAGGATGTGATGGTCCAGAATTATGAGAACCTGGTCTCTGTAGGTCTTTCC
GTAACTAAGCCATATGTGATCATGTTATTGGAGGATGGAAAAGAGCCCTGGATGATGGAGAAAAAACTG
TCAAAAGCTTACCCATTTCCTTTATCACACTCTGTTCCTGCTTCTGTGAACTTTGGATTCTCTGCTCTA
TTTGAGCATTGTTCAGAAGTCACTGAAATATTTGAGTTGTCAGAACTATGTGTTTTCTGGGTGCTTCAT
TTCTTATCCAATTCTCCTAATTCCACTGTAGAAGCTTTTTTCAAGAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_018675
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_018675.2
RefSeq Size 3195 bp
RefSeq ORF 396 bp
Locus ID 55900
UniProt ID Q9NR11
Domains KRAB, zf-C2H2
Protein Families Transcription Factors
MW 15 kDa
Gene Summary This gene encodes a member of the zinc-finger protein family. The encoded protein contains seven C2H2-type zinc fingers and a KRAB domain, but its function has yet to be determined. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (15) differs in the 5' UTR, lacks an alternate in-frame exon, and uses an alternate splice junction compared to variant 1. The resulting isoform (e) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a. Variants 12, 13, 14, and 15 all encode the same isoform (e).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...