ACYP1 (NM_001302617) Human Untagged Clone

CAT#: SC333772

ACYP1 (untagged) - Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 4



  "NM_001302617" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-ACYP1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACYPE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333772 representing NM_001302617.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGCGTCCGCCCGCCTGGCGGGAGCGGGGCTGCTGCTGGCCTTTCTCCGCGCGCTCGGCTGCGCT
GGGCGGGCCCCAGGTTTGAGCATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGG
AAGGTGCAAGGGGTGTTTTTCCGTAAGCATACTCAGGCTGAGGGTAAAAAGCTGGGATTGGTAGGCTGG
GTCCAGAACACTGACCGGGGCACAGTGCAAGGACAATTGCAAGGTCCCATCTCCAAGGTGCGTCATATG
CAGGAATGGCTTGAAACAAGAGGAAGTCCTAAATCACACATCGACAAAGCAAACTTCAACAATGAAAAA
GTCATCTTGAAGTTGGATTACTCAGACTTCCAAATTGTAAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302617
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302617.1
RefSeq Size 815 bp
RefSeq ORF 390 bp
Locus ID 97
Protein Pathways Pyruvate metabolism
MW 14.1 kDa
Gene Summary This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) uses an upstream alternate 5' terminal exon and lacks an alternate exon, compared to variant 1. The encoded isoform (c) has a longer N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...