RAN (NM_001300797) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ARA24; Gsp1; TC4
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333753 representing NM_001300797. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTGATGTAACATCGAGAGTTACTTACAAGAATGTGCCTAACTGGCATAGAGATCTGGTACGAGTG TGTGAAAACATCCCCATTGTGTTGTGTGGCAACAAAGTGGATATTAAGGACAGGAAAGTGAAGGCGAAA TCCATTGTCTTCCACCGAAAGAAGAATCTTCAGTACTACGACATTTCTGCCAAAAGTAACTACAACTTT GAAAAGCCCTTCCTCTGGCTTGCTAGGAAGCTCATTGGAGACCCTAACTTGGAATTTGTTGCCATGCCT GCTCTCGCCCCACCAGAAGTTGTCATGGACCCAGCTTTGGCAGCACAGTATGAGCACGACTTAGAGGTT GCTCAGACAACTGCTCTCCCGGATGAGGATGATGACCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001300797
Insert Size	387 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001300797.1
RefSeq Size	2500 bp
RefSeq ORF	387 bp
Locus ID	5901
UniProt ID	P62826
Protein Families	Druggable Genome, Transcription Factors
MW	14.7 kDa
Gene Summary	RAN (ras-related nuclear protein) is a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The RAN protein is also involved in control of DNA synthesis and cell cycle progression. Nuclear localization of RAN requires the presence of regulator of chromosome condensation 1 (RCC1). Mutations in RAN disrupt DNA synthesis. Because of its many functions, it is likely that RAN interacts with several other proteins. RAN regulates formation and organization of the microtubule network independently of its role in the nucleus-cytosol exchange of macromolecules. RAN could be a key signaling molecule regulating microtubule polymerization during mitosis. RCC1 generates a high local concentration of RAN-GTP around chromatin which, in turn, induces the local nucleation of microtubules. RAN is an androgen receptor (AR) coactivator that binds differentially with different lengths of polyglutamine within the androgen receptor. Polyglutamine repeat expansion in the AR is linked to Kennedy's disease (X-linked spinal and bulbar muscular atrophy). RAN coactivation of the AR diminishes with polyglutamine expansion within the AR, and this weak coactivation may lead to partial androgen insensitivity during the development of Kennedy's disease. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.