GPIHBP1 (NM_001301772) Human Untagged Clone

CAT#: SC333728

GPIHBP1 (untagged) - Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), transcript variant 2



  "NM_001301772" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-GPIHBP1 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPI-HBP1; HYPL1D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333728 representing NM_001301772.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGGCAGACACAG
CAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTG
GAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAG
TCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTC
ATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAG
CCCATCACCAAGACGGTGGAGGGGACCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301772
Insert Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301772.1
RefSeq Size 625 bp
RefSeq ORF 378 bp
Locus ID 338328
UniProt ID Q8IV16
Protein Families Druggable Genome
MW 13.9 kDa
Gene Summary This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (2) lacks a segment in the 3' UTR and 3' CDS, compared to variant 1. The encoded isoform (2) has a shorter C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...