GPIHBP1 (NM_001301772) Human Untagged Clone
CAT#: SC333728
GPIHBP1 (untagged) - Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GPI-HBP1; HYPL1D |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333728 representing NM_001301772.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGGCAGACACAG CAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTG GAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAG TCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTC ATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAG CCCATCACCAAGACGGTGGAGGGGACCCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301772 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301772.1 |
RefSeq Size | 625 bp |
RefSeq ORF | 378 bp |
Locus ID | 338328 |
UniProt ID | Q8IV16 |
Protein Families | Druggable Genome |
MW | 13.9 kDa |
Gene Summary | This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) lacks a segment in the 3' UTR and 3' CDS, compared to variant 1. The encoded isoform (2) has a shorter C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235834 | GPIHBP1 (myc-DDK-tagged) - Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), transcript variant 2 |
CNY 3,990.00 |
|
RG235834 | GPIHBP1 (tGFP-tagged) - Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), transcript variant 2 |
CNY 4,370.00 |
其它GPIHBP1产品