FGF5 (NM_001291812) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	HBGF-5; Smag-82; TCMGLY
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333719 representing NM_001291812. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAAAAAAAGGAAAACTCCATGCAAGTGCCAAGTTCACAGATGACTGCAAGTTCAGGGAGCGTTTT CAAGAAAATAGCTATAATACCTATGCCTCAGCAATACATAGAACTGAAAAAACAGGGCGGGAGTGGTAT GTGGCCCTGAATAAAAGAGGAAAAGCCAAACGAGGGTGCAGCCCCCGGGTTAAACCCCAGCATATCTCT ACCCATTTTCTGCCAAGATTCAAGCAGTCGGAGCAGCCAGAACTTTCTTTCACGGTTACTGTTCCTGAA AAGAAAAAGCCACCTAGCCCTATCAAGCCAAAGATTCCCCTTTCTGCACCTCGGAAAAATACCAACTCA GTGAAATACAGACTCAAGTTTCGCTTTGGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001291812
Insert Size	378 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001291812.1
RefSeq Size	5118 bp
RefSeq ORF	378 bp
Locus ID	2250
Protein Families	Druggable Genome, Secreted Protein
Protein Pathways	MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
MW	14.5 kDa
Gene Summary	The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified as an oncogene, which confers transforming potential when transfected into mammalian cells. Targeted disruption of the homolog of this gene in mouse resulted in the phenotype of abnormally long hair, which suggested a function as an inhibitor of hair elongation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.