GAJ (MND1) (NM_001253861) Human Untagged Clone

CAT#: SC333695

MND1 (untagged) - Human meiotic nuclear divisions 1 homolog (S. cerevisiae) (MND1), transcript variant 2



  "NM_001253861" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MND1 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GAJ
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333695 representing NM_001253861.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAAAGAAAAAAGGACTGAGTGCAGAAGAAAAGAGAACTCGCATGATGGAAATATTTTCTGAAACA
AAAGATGTATTTCAATTAAAAGACTTGGAGAAGATTGCTCCCAAAGAGAAAGGCATTACTGCTATGTCA
GTAAAAGAAGTCCTTCAAAGCTTAGTTGATGATGGTATGGTTGACTGTGAGAGGATCGGAACTTCTAAT
TATTATTGGGCTTTTCCAAGTAAAGCTCTTCATGCAAGGAAACATAAGTTGGAGGTTCTGGAATCTCAG
TTGTCTGAGGGAAGTCAAAAGCATGCAAGCCTACAGAAAAGCATTGAGAAAGCTAAAATTGGCCGATGT
GAAACGGCCAAGCAAATAAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001253861
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253861.1
RefSeq Size 830 bp
RefSeq ORF 369 bp
Locus ID 84057
Protein Families Druggable Genome
MW 13.8 kDa
Gene Summary The product of the MND1 gene associates with HOP2 (MIM 608665) to form a stable heterodimeric complex that binds DNA and stimulates the recombinase activity of RAD51 (MIM 179617) and DMC1 (MIM 602721) (Chi et al., 2007 [PubMed 17639080]). Both the MND1 and HOP2 genes are indispensable for meiotic recombination.[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...