VAMP1 (NM_001297438) Human Untagged Clone
CAT#: SC333624
VAMP1 (untagged) - Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CMS25; SPAX1; SYB1; VAMP-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333624 representing NM_001297438.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGCTCCAGCTCAGCCACCTGCTGAAGGGACAGAAGGGACTGCCCCAGGTGGGGGTCCCCCTGGC CCTCCTCCTAACATGACCAGTAACAGACGACTACAGCAAACCCAGGCACAAGTGGAGGAGGTGGTGGAC ATCATACGTGTGAACGTGGACAAGGTCCTGGAGAGGGACCAGAAGCTGTCAGAGCTGGATGACCGAGCT GATGCCTTGCAGGCAGGAGCATCACAATTTGAGAGCAGTGCTGCCAAGCTAAAGAGGAAGTATTGGTGG AAAAACTGCAAGATGATGATCATGCTGGGAGCCATCTGTGCCATCATCGTGGTAGTTATTGTAAGAAGA GGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297438 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001297438.1 |
RefSeq Size | 1453 bp |
RefSeq ORF | 351 bp |
Locus ID | 6843 |
UniProt ID | P23763 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
MW | 12.6 kDa |
Gene Summary | Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (4) contains an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Isoforms 3 and 4 are the same length but differ in their C-termini. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235730 | VAMP1 (myc-DDK-tagged) - Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 4 |
CNY 3,990.00 |
|
RG235730 | VAMP1 (tGFP-tagged) - Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 4 |
CNY 4,370.00 |