VAMP1 (NM_001297438) Human Untagged Clone

CAT#: SC333624

VAMP1 (untagged) - Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 4



  "NM_001297438" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-VAMP1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMS25; SPAX1; SYB1; VAMP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333624 representing NM_001297438.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTGCTCCAGCTCAGCCACCTGCTGAAGGGACAGAAGGGACTGCCCCAGGTGGGGGTCCCCCTGGC
CCTCCTCCTAACATGACCAGTAACAGACGACTACAGCAAACCCAGGCACAAGTGGAGGAGGTGGTGGAC
ATCATACGTGTGAACGTGGACAAGGTCCTGGAGAGGGACCAGAAGCTGTCAGAGCTGGATGACCGAGCT
GATGCCTTGCAGGCAGGAGCATCACAATTTGAGAGCAGTGCTGCCAAGCTAAAGAGGAAGTATTGGTGG
AAAAACTGCAAGATGATGATCATGCTGGGAGCCATCTGTGCCATCATCGTGGTAGTTATTGTAAGAAGA
GGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001297438
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001297438.1
RefSeq Size 1453 bp
RefSeq ORF 351 bp
Locus ID 6843
UniProt ID P23763
Protein Families Secreted Protein, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 12.6 kDa
Gene Summary Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) contains an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Isoforms 3 and 4 are the same length but differ in their C-termini.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...