CXCL11 (NM_001302123) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	b-R1; H174; I-TAC; IP-9; IP9; SCYB9B; SCYB11
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333550 representing NM_001302123. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGTGAAGGGCATGGCTATAGCCTTGGCTGTGATATTGTGTGCTACAGTTGTTCAAGGCTTCCCC ATGTTCAAAAGAGGACGCTGTCTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGATATTGAG AAAGCCTCCATAATGTACCCAAGTAACAACTGTGACAAAATAGAAGTGATTATTACCCTGAAAGAAAAT AAAGGACAACGATGCCTAAATCCCAAATCGAAGCAAGCAAGGCTTATAATCAAATTGAAAGAAAGAATT TTTAAAAATATCAAAACATATGAAGTCCTGGAAAAGAGCATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001302123
Insert Size	321 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001302123.1
RefSeq Size	1603 bp
RefSeq ORF	321 bp
Locus ID	6373
UniProt ID	O14625
Protein Families	Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways	Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Toll-like receptor signaling pathway
MW	11.8 kDa
Gene Summary	Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This antimicrobial gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) uses an alternate splice junction in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (2) has a longer and distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.