Mago nashi homolog 2 (MAGOHB) (NM_001300739) Human Untagged Clone

CAT#: SC333496

MAGOHB (untagged) - Human mago-nashi homolog B (Drosophila) (MAGOHB), transcript variant 2



  "NM_001300739" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MAGOHB rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms mago; magoh; MGN2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333496 representing NM_001300739.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCAGAAAAGAGGCTTATGTGCACAAGAGTGTAATGGAAGAACTGAAGAGAATTATTGATGACAGT
GAAATTACAAAAGAAGATGATGCTTTGTGGCCTCCCCCTGATAGGGTTGGCCGACAGGAGCTTGAAATT
GTAATTGGAGATGAGCACATATCTTTTACCACATCAAAAATAGGTTCTCTTATTGATGTAAATCAGTCA
AAGGATCCTGAAGGCCTTCGAGTATTTTACTATTTGGTACAAGACTTGAAATGTTTAGTTTTCAGTCTT
ATTGGATTACACTTCAAGATTAAACCAATTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300739
Insert Size 309 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300739.2
RefSeq Size 2777 bp
RefSeq ORF 309 bp
Locus ID 55110
Protein Pathways Spliceosome
MW 11.8 kDa
Gene Summary Required for pre-mRNA splicing as component of the spliceosome (PubMed:28502770, PubMed:29301961, PubMed:30705154). Plays a redundant role with MAGOH in the exon junction complex and in the nonsense-mediated decay (NMD) pathway (PubMed:23917022).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' structure and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...