alpha Defensin 1 (DEFA1B) (NM_001302265) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	HNP-1; HP-1; HP1
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333495 representing NM_001302265. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGATGGTGACCCCAGCCATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTGCAG GCCCAGGCTGAGCCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAGATTGCAGCGGAC ATCCCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAGCTTGGCTCCAAAGCATCCAGGCTCAAGGAAA AACATGGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTCGCTATGGAACCTGCATCTAC CAGGGAAGACTCTGGGCATTCTGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001302265
Insert Size	306 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001302265.1
RefSeq Size	542 bp
RefSeq ORF	306 bp
Locus ID	728358
Protein Families	Druggable Genome
MW	11 kDa
Gene Summary	Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.