Apc11 (ANAPC11) (NM_001289418) Human Untagged Clone

CAT#: SC333439

ANAPC11 (untagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 12



  "NM_001289418" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ANAPC11 (Apc11) mouse monoclonal antibody, clone OTI3C4 (formerly 3C4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APC11; Apc11p; HSPC214
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333439 representing NM_001289418.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGAACTGTGGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGTGAGTGTCCCCTCCATG
CTGTCTGAGCGGCCCCGACTGCAAGGTGCCCGGCGACGACTGCCCGCTGGTGTGGGGCCAGTGCTCCCA
CTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTGCAGCAGCACTGCCCCATGTG
CCGCCAGGAATGGAAGTTCAAGGAGTGAGGCCCGACCTGGCTCTCGCTGGAGGGGCATCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001289418
Insert Size 270 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289418.1
RefSeq Size 893 bp
RefSeq ORF 270 bp
Locus ID 51529
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
MW 9.1 kDa
Gene Summary Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (12) uses an alternate splice site in the 5' UTR and an alternate splice site in the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Variants 12 and 13 encode isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...