ZNF189 (NM_001278240) Human Untagged Clone

CAT#: SC333421

ZNF189 (untagged) - Human zinc finger protein 189 (ZNF189), transcript variant 5



  "NM_001278240" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-ZNF189 Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333421 representing NM_001278240.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCCCCGAGCCCCCCGCCGGAGTCGAAGGAGGAGTGGGATTATCTGGACCCAGCTCAGAGAAGC
CTGTATAAAGATGTCATGATGGAGAATTATGGAAACCTGGTCTCACTGGGTCTCACTCTATTGCCTAGG
CTGGTGTGCAGCGACGCAAACACAGCTTGCTGCAGCCTCAACCTGTTGGGCTTAAGTGATCAATCCTCC
CACCTCAGCTACCTGAGTAGCTGGGACTACAGATGTTTTGAACAGAGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278240
Insert Size 258 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278240.1
RefSeq Size 3292 bp
RefSeq ORF 258 bp
Locus ID 7743
UniProt ID O75820
Protein Families Transcription Factors
MW 9.6 kDa
Gene Summary Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]). Approximately 30% of human Kruppel-like zinc finger proteins contain an N-terminal Kruppel-associated box (KRAB) domain. The KRAB domain consists of approximately 75 amino acids that may be subdivided into an A box, which is present in every KRAB domain and is essential for transcriptional repression, and a B box, which is not always present.[supplied by OMIM, May 2010]
Transcript Variant: This variant (5) uses an alternate splice junction at the 5' end of an exon and contains an alternate 3' exon compared to variant 1. The resulting isoform (5) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...