Apc11 (ANAPC11) (NM_001289416) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	APC11; Apc11p; HSPC214
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC333415 representing NM_001289416. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATGAGAACTGT GGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCCGGCGACGACTGCCCGCTG GTGTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTG CAGCAGCACTGCCCCATGTGCCGCCAGGAATGGAAGTTCAAGGAGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001289416
Insert Size	255 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001289416.1
RefSeq Size	914 bp
RefSeq ORF	255 bp
Locus ID	51529
UniProt ID	Q9NYG5
Protein Families	Druggable Genome
Protein Pathways	Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
MW	9.8 kDa
Gene Summary	Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (10) lacks an exon in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.